EST 667626 is a singleton


Sequence

>667626 (1 EST) Length=578 CAAATATGTCTNNNATTACACCAATCGGGGAGCCTAGATGTNAANACAGATTGCCAGTGTTCGACAGACAANTAAAATTA GCACATAGTGTCCAGTGTTAAAATTCATAGAAAAGATTATTCTGTAAATGACTTGGGGATAGGAATTTGTTCAGCTATTT CTAAGCATCACATATACCTATATTTGTCTACTGGTTTGATGGTAGAGAGAAGGGAAGAAAGTGGGTCNAAGCCCAAATGG TTATATTTAGAANATATCTCCGATAATAACCATTGCTTTGCATACAGTTTTAATTACAAGTGCCATGTTATAAGTTCTTA ACATGAAATACCTAGATATTTGGAAGTGCTTGATATATTTAAAGGTAGAAGTAGTAGAATAATAGTATTTTGTGTAAATA GTTTTTTTAACTTAGAGAAATACTGTGTTTGGAAATAGAATTGTTAGCCCACCTCTGAGCACAGTTGCCAGCTGTACTTG TTCANTGGCTTGANGAAGAAGGCGGGAAGAAACTGCCAGAGTCCATTAATGTGCTAGACAGGTTCAGCTTACCACCACCT GTACGCTATGCATCTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 667626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676261537106AA051939SWMFCA743SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 22:34:33 on Tue 21 Nov 117.