EST 667638 is a singleton


Sequence

>667638 (1 EST) Length=596 CTCGTGCCGTTGATATATCAAAGCATTTCCGAAATGACAGCACTGACGGCTCGCCGTACCAGCTTTAAAGAAACAATAGA GCATAATGCTTTACCGGAAAATATCAGTAGACGTGCCGTAACACAACAACAACGGCAACGCATTATTGATGAAATATATC CGGAATTGTCACTGGATCAAGATAAGAAGCATAAAGTAAAGCTACAATACAAAACACCATCACTACCTGCTACAATCGAA GATGCTTGTGAAGATGAGGAGTCAGTAGCTATAAGCAAGTGCTTCTCTTCCACCAGAAGCCTTGACGGACGTTCACCATA TGCTTTACCGCCAGAAGAACTTTTCCAACACAGTCTCCTCACAAATCAGGATTTATTCTCTAATCCTATTATGAGTGCAA AGTTCCGAGCATCGCCCTTTAAGATCGCTTCGGGACGATAAAAACAACCCCCTGGCTGTCACGAAGGATTTAATGATTCT ATCATACGGGAACAAAAGATCACTCTCATTACTTGGTGAGCGCCCCAAGTTAGCCGCAAATTTTGAGTCCCTTTCTGCAG ACTTTTTGGATTTACACAATCCGAACTGTCACTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 667638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676381537118AA051951SWMFCA837SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:16:20 on Mon 20 Nov 117.