EST 667648 is a singleton


Sequence

>667648 (1 EST) Length=577 GTTTGAGGCATAATGCATACGGCCTGGGCACGTGCTAATGCGATATTTGCGTTTGTTCTTTCTGTCTTATCAGCCTTAAC GTTTTGCGTTTTCGTGTCCACTGTTTGGTTACCGAACTCGGCACCAGTTACTTTATCAGCGAGTAATATTCGCGTGAAGA ATTTCGTAGATTATGCCTCAGAGGGTTCACGAAGTGATGTAGTAATGGCAGACCTGAAGATAAAAGTTGATGTTGCTCCC ATATTTAATTGGAATGTTAAAGAGATCTTTTTATTCCTTGTAGCAGAGTACAGTACACCAAAAGCACCTCTTAATCAGAT TGTACTTTGGGATAAAATCTTGAGACGTGGCGACTGGTCGGCAATACACGAAGAGAGCATTACACCAAAATACTACTTTA TGGATGATGGTACCAATCTACTAAATCACAAAAATGTAACTCTTGTACTGAGATGGAATGTGGTACCGAATGCAGGTTAT CTGGCAATTGCACAAGGTGAAGGACAATATCGGTCCAATTCCATCCAGTATACAGTGGTCGATTTAGGAGATAATGTAAC ATAATTTTGTCGTGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 667648: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676481537128AA051961SWMFCA853SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:38:1 on Fri 17 Nov 117.