EST 667669 is a singleton


Sequence

>667669 (1 EST) Length=276 CACGCACGGATGCAATTGCATGCTCACATTGAAATTGTGTGTTCAATGCAAATACATGAAGGTGTTTTTTGAAGAGTGGT GCCTGGCGAGTTAGAGGCAGGTTTAAGGCCTATATCCTGTTAATCTTAGGGTTTGTCACATCGTAGATGCTTTTGCGCCG TTTCTTGGCGCGCAGAGCCCTTGCTAGTTTGGTTGGCGTTCCTGTCCTCCGCTTGGCGGACTCGGCATTTACGTGGAGTA TCGCCAGAGTATCCGCGCCTTCTATCTCGGCCTCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 667669: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676691536852D87225D87225Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 4:16:55 on Mon 20 Nov 117.