EST 667671 is a singleton


Sequence

>667671 (1 EST) Length=353 CGCTAATCAATAAAAGCGAACGACGGCAACGATACGTTGGTGTTCTTTCCCCATTGCGTGAAGCGGAGGAGGAGGGGGAA GGCACAAGAAGGAAACGGCGGGGAGGAAAAATAAGCCGGGGAGGGGAATAAAGGCGGGAGTTACAACGGCATCGCTGGAG GAAGGGAAAAAAAAAATACTTGAGAAATGAGGGAACACCCTCACGAGAAGTTGTGTTCCACGTAAGAGTGAAGCGAAGTA AACAAATGAATGCACTTTTATTTACTTCCCCTCTTATGTCCCTGCATTCCTTTTGTATTTTCATTGTTTGTTTTGTCATC TGTGGAAGATGGTGCCCTCGCCCCCTTACTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 667671: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676711536858D87229D87229Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 6:10:11 on Wed 22 Nov 117.