EST 667672 is a singleton


Sequence

>667672 (1 EST) Length=488 GACGGTTCCGCCGATGCAGAACGTCGTGCCAAATTGATGCTTTTGTGGGATGTCTTCAACGGTGTGACCCGTCGTGCGTG GAGCGGAAATGCGTGTGGCCATGAGGCTATGCTGCGGGCGGTATCCCGCGTGGAGGGATTGCATGTCACTGTTCCCCAGC ATGTTCATCCCGATGTGCTTAAGAAGTATTAGCAGGACGTGTCACCTAACACGTTCCTGTCCTCCCATTATCTTTCTTCT TTATTGTTGTTTTAATGCCCCTACACACAATTGTTATTTTGACGTATCGAGAAAAACAAAAATCTGTCCACAAGTTTATA TATGAAAACCACACAAATAAAACAGAAGAAAACAAGAAAATGGTTTATGGAGGCTCAACGCAAAACGGGGCTTTCTCTTT TTTTAATTGATGCCGCGGTGGCATATCTGTGTGGTGGTGGTGTGTGTGTTTTTCCCCCTTTTTCTGGTGTGAAAAATAGG GAAAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 667672: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676721536859D87230D87230Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 2:34:58 on Sat 25 Nov 117.