EST 667673 is a singleton


Sequence

>667673 (1 EST) Length=423 GTTCATGCGGCGGGCTATGTGGCACCACGGCATCCCACAGCACCTGCGCGGCGTGTTGTGGCTAACGATATCTGGTGTTG CGTCGAAGATGGATGAGAATCAGGGTTTCTGTCGAGCACTTTTGAAGCGTCATGGATACATACGTGGCGAGTATGCCGAA GCCATTGAAAAGGCTCTCCGCCGCACTTTTCCCGAGCATCGATATTTTGCGGACGGTGGGTTGGGGATTCGAAAGGCACG GAATGTTCTGCATGCTCTGTGTTGGCGCAATCCACTTTTGAACTATTGCCAGTCGTTCAACTACCTTGTTGCCTTTATTC TGTTGGGTGGTTGACGATGAGCGAAAGCACCTTCTGGCTTATGTGTCACCTAACTAGAAAACTTAAGTGGCCCTCAACGA CTTGTTACTCCGGACATTCACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 667673: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676731536860D87231D87231Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 14:38:10 on Fri 17 Nov 117.