EST 667674 is a singleton


Sequence

>667674 (1 EST) Length=280 TTCCCCCTTTTCTCTTTTTTTTTACTTTCCCTTAACAAAAGAAGGAGAGGATTTTTAATGCGCAGCGCGTTGTTTGCGAC TTTGATTCATGCCTGCTCCTTTGTCTTTACTTTAATTTCTCTGCTGTTTTGTTTCGTTTTGTTTTGTTTGTTTTGCGTGT GTGTGTGTCTGTCTTTGATGGGGGGACGTTGATTGGTGGGAGCAGCACACACCGCAGTCGGTGGTACATGCCTGTTTGGG GGGGGGCGCAGGGTGGTGGTGTTTGATATGTGAATTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 667674: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676741536861D87232D87232Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 14:48:41 on Sun 19 Nov 117.