EST 667676 is a singleton


Sequence

>667676 (1 EST) Length=591 CTTGCCACGGCGCGTGGGTTTTTCCGCAAAAGCTGGCTTCGTTGCATCCGCCGCAACTGCAAATGTTGGTGGAATCTTCT CCAGTGCTCCCTTGTATGAGAGCGCCTCTAAACCGATTGTCTGCACCATCTCCGCTACATCCGCCGCAGCCACACGCTGG ACAAGATCCACAAACTTAAAGCGGTTAAGAAGGATGGCGTGCTCCGTAGCCGGCAGAGTGAGGAGGCGTGCAGACAGTGT CTGATCCTCCCCACTCAATGGCATTGCTCCTCACCGTAGAAGAAACCAACCCCGGTGGTGGTCGCGTTACGGACTGGTGT AATTGGAGAAGATAGGCCAGTTTTTACCCTATTCTATAATTTCCTCCCTCCCTCCCCTGGCAAAGGATGAGAAAGGGCTA TTTTTTTTTTTCCCCAAGGGATTGGAATGGTGTTGTAAACAAACACAGAGATAAACAAGGGATATAACAGAAAGAAAAAA GAGAAGAACATGCACCGACCAAAGTCGTCCAGCCCGCTTAACAGCTGGACCAACAATCGTTGATGGGGGTCTGGAAAGCA CCCGAAAGCAGTTNGGCAGTTCATTAACTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 667676: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676761536863D87234D87234Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 2:42:20 on Fri 24 Nov 117.