EST 667677 is a singleton


Sequence

>667677 (1 EST) Length=712 TATTGTGAGGTGAGTAGGCAGAAGGCACAATGGCCCAACGCGTTGCCATTCCTGATGACTGCGTATACGAGGGATACGGT AATCTTTACCGCGGAGATGCGGAGGTGACACCGCCCCAGCCGATTGTGGGAGCACGTGGCGGCAATGGTGTCTTGTACGG CACCATTGATAGCGAGGAGGCACTGCGGCAACTCCGCACCGCGCTCCGCGTCGACGTTCATCCGCAGCTGAAGGCGCTCG TGCAAGAAAAGAAATTAGACGAAGTGGCGTCATCACCGGCAAGCCTGCCCTGGCTGGTCTGTCGCCCGAATGCACCGCAG TTGAGGACGTTGCCTTCGTCCTTTTCATCAGGGACGCGATATGAGATTGAGCGGATGAAATCGCCATGTCGCTTTCTGCG TTGACTGGCTTATGTGGCCACGAAACTCTGAGGAACGTGTTAGAAAGCGAAGGGAAGTTTTTGGCGCACGGGCACAGGGG CCTCTTGCAGAAAGGAGTCTGTAGGAGGAGCTGTTTGGGGTCGTACAGAAAAACCTGGCTCCAGCAGTTNGGAGAATTGG CCCCNGCTGGTGGGTTTGAAAAAGGGCCCGTTCCCCATATTAGGCAGAATGGAAACGACNGACAAATCCATTGACTGGAT TGGCGTGAATTTGTCGGGGGANGTGCTTGGAAANANAATGAGGTTTGCGCACGAATTGTCGAAGTTGAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 667677: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676771536864D87235D87235Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 2:37:37 on Fri 24 Nov 117.