EST 667678 is a singleton


Sequence

>667678 (1 EST) Length=512 CAAAAATGCCCTTCGCTGATCATAAAAAGTACAAGATTCAACGGGAGGAAATGCCCGCCGTTCCTCACTTTTCCGACTTC AGTGACCCACGGTTCAGCTACACAGCCAACAAGCAGAAAAATGGAATTCTTGCCTACTATCAATGGCTTCACTGCATCGG CAACTGGGGCGAGGAACACTCTATGTGCAAGAAAATGCGCTGGTACCTAGAGCGAATGATGCANGAGTCGTGGCTGGAGA AGTGGGAAGAGAAGCGTGCCCTAGGACACTTTGATCACGTTATCCTCTATGGTGTGAAGCCATGGAAGGAGTTTGAGCCG TTGTACCAGCCCGTGGAAGAAGAATCGTAAAAGGGCGCCTATGGAGTTTTGGTTGGATCGCGACTTTGAGCCCCTTTACG ATGCGGATGACAGCGGACTTTCGTGGAGAAGGCGCCAATCCTTCATGATGTGCTTTGGTTGAATGGGCAAGAAGCCCGTG TATGATTGGAGTTGGGGGGTTAGGGAACAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 667678: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676781536865D87236D87236Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 1:48:19 on Sat 18 Nov 117.