EST 667680 is a singleton


Sequence

>667680 (1 EST) Length=558 GATACAGTTTCTGTACTATATTGAGGGGCCCAAGGTAAAGGGGTAGAAGCCTTAGGAGACGAAGGCGTTTTTGTGCGTGT GTGTGTGTGCGGCGGCAAATGGTGGAGCTCATCATAGANACCAACGCTGATATTGACTTGCTTCTCCGTGAGCTTCAGCG ACTGAACGGGTCGCTGAANAAAATAGATCCAAGGCGGGGTGCTGTTCTTCTTTGGGGCGAAATTTACAGTGACTCCACTC TCCAGGACTTGTTTCAGGAGCGTCTGGCGAGTGTGATGAAGTGCCGCTAAGAAGCAACGTGCCATTCACTTTCCCCGCGA GCGTTTGTTGATTGGAAACTACGAAAGAGGTTGAAGTGGAGTTGTTGGCGCCGCACCTTCGCATCCTGCCGGAGAGCGCG ATCCGCAGCAATGCCAAGCAAGGAGGAGCGTAAGCGGCCTTTAAGGAGGACGAAGTTGGAGGGCACTCGAGGGCGCACAA AGGAGAAAATGCTGGAGACTTGGCCATGCCAGGGCATTGAATTTTGCCGGAGCGGGAAAGAGTGGAAAGCCCTCCAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 667680: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676801536867D87238D87238Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 16:34:0 on Sat 18 Nov 117.