EST 667681 is a singleton


Sequence

>667681 (1 EST) Length=534 GATTTTTGGGGGACACCCGCCAGATTTTTGGAGAAGAATTTTTGGAGGAAGTTTTTTGGGGGGAGAGTTAGAGGAGGAGA GGGAAGGAACGGGAGAGGAACGTTTTGGTCTCATAATGAGAGGATTTTGGAAAAAGGCAACCGAGGGAGAAGGGATTTGG CTTTTTTTGGACCAAAGGAAGGAAGGGAGGAAGAGTAAGGAAAAACAATAGATGCGTTGTTATTGTTTATTTTTTATTTT GTGTTGTGTATTTTTATTTTTTGTTTGGTTTTTGTTTGTGTTTTGTATTGTGATTGAGTTTATTATTTGGTTTTTTATTT TTGTGAAACCAATTGTGGGAATTTACATTATTATTTGTTACATTAAGTTGTGGTGTTTTTGGTTCCATTTTATTTTTAAT TGATTTATTACATTTTACACATGTTTTTTTAGGTGTATTTTTGTTGTTTATTTGTTTTGGTCGTTTATTTAATTTTTTGT GTATGGATACACGTTTTGTTTTTTTGTAAGGTTGGTTTTGTTTGTATTGACATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 667681: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676811536868D87239D87239Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 2:33:58 on Fri 24 Nov 117.