EST 672206 is a singleton


Sequence

>672206 (1 EST) Length=485 ACGGAAATGACTGATAACAACACAACAGAAATTCAAGTTGTACTACAGAAAGAAGCAATCGACGTCGATGATCAAACGAT GACCAAAATTTCAACAAAATCAGTAAGAGGAAAATCGGAAATTGTACAAATAACTGATGAAAGTTTTACTGATGATCTCA TCGAGATTGATGATGAGATGGAAATGAGTAAAATCAGCAATGATATGGTTAAAAAATTGCTAATGTGTGATAAAAATGAG CAAAAAATTGATGAAAATAAAAAAACTAAAGATAGTCTACCAAAAATATCGAAAGAGTATGATGAGGTAGAATTGCTTCG AGAGATTGCCAAGAGGCCTCTGGAATGGTTTAAAAATATGAAAGATGTNCCGGATGCTATTGCAAAAATTTATTATAAAG ATATCAGTCGTCGTTGGCNGCAATCAGAGATACGTATCAAAGAAACCGAAGAATTACTTTCGAATGTGAAATATGAAGAA CGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 672206: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722061537153AA051988SWAMCA1468SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:27:29 on Fri 17 Nov 117.