EST 672210 is a singleton


Sequence

>672210 (1 EST) Length=112 GTTCTAATGAAATATCTAACGAACAAAAACTTTTCCTTTTACTGTCAGCACCTTTCACTCATTTGTGTTCTTTTTATTAT ATATCACATCTAAATAAACACATTCACTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 672210: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722101537157AA051992SWAMCA1472SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 9:26:40 on Sun 19 Nov 117.