EST 672211 is a singleton


Sequence

>672211 (1 EST) Length=481 GACGGAGCGAATGCTGCGAATAAAGTTGATGGCACTGAGGGCAGTCACGTGAAAGTTGCCGAGAAACTACAGCAAGCGTT GAAAACTCTGCAACAAGATGATGTGGAAATGACACAAGGTTATCGGCCATTAACTCGTGAAAAAACAGTTTCATTAGCTG ACTGTTGCGCATTGTATCGGTTGGAGACAAACCTAAAGGCAATGGAAGAGCTACTGGATATACAAGCAAGCTTGGATAAA TGGTTCGAGAATAATAAAGCTAATGTGGCCAAACACAAGGAATTATTAAAAAATTTGTTAACTAATGCTCTTACCAATTT TGAAATGGCATATATAATCACCGAGTTATTTGCTATTCCACAAGTGTCGCTACAAGAAATCCAGAAAAATAAACCGGAAT ATAGCAAATACATTCGATCAAATATTGGCGCAAGGAACATCGCCATTATCAACAAGCCACTAAATAAGGGAATTATTACG A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 672211: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722111537158AA051993SWAMCA1473SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 3:42:39 on Sat 18 Nov 117.