EST 672221 is a singleton


Sequence

>672221 (1 EST) Length=98 CTTCACACTAACTTGACCGACTTTCTGGTGCAAGTACAGTGCCCCTCTTAGACGTTTTCACTTATTAGTAACTATTTAAA GAAATCGAGAAAAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 672221: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722211537168AA052003SWAMCA1483SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 5:10:25 on Tue 21 Nov 117.