EST 672224 is a singleton


Sequence

>672224 (1 EST) Length=439 TTGATGCCTTGTTAGCATTGCTTACAAGAATTTCACAATCCTTTTCTTTTTGCTTAATCGGTAAAATCGAGTCATTTTTA ANAAAGCATAGAAATTTTCGCTGGGTTTTATTTCCTCATAGTTTTATCCTACCATTAATTATTTCATTCTTAAACTTAAT ATTACAATTTACTGTTGTTCTAACCATTATTTCAGGGATTTGCTTTTCTTAAGACACGGTGGATGTGAATGATTTCATGA TTGCCTGTAAACTTTTTAAAGGGTCTCTTCTGGTCCTGAATTTTTTTATTATTTGCTACTGCTATTATCACAGCTACTAC TACTAATTACTTTCACTACTACTGCTACTGTCACTACTACCTCGTTCTACGAAACTATATGTTCATGTCGAAAAAAAAAT AGCACAGTTCCTCTATATTTTCCCTCACTTTTATGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 672224: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722241537171AA051964SWAMCA1486SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 18:43:17 on Sat 18 Nov 117.