EST 672230 is a singleton


Sequence

>672230 (1 EST) Length=434 TAAACGCGATCGAAGTGGCCCAGGCCCAGCATTCTGGTCCAGGATACTGTGTCTTCTGTTAACAGGTATAAAGACAATGA ACAGGAAACGAGAAATGTTGCACATGAAACAGCTATTTCAGTTGGATAATCATAGTCTCATTGTTTCACCACATTAGAAC TAATCGAATATTTCGACAATTATTTGCTCGATGTATTGGAGTTGGAAAAAGGATTCATTGTCGTAATTTAAAGATGCAAA GTGTGGCGTCTCTGGAGTTATGGGAGCAAACTGAGTTTGGGATCGGTCAGGAAATTTTGAAATTTGAACTTCCATGCTAA GAACCTCCATAGTTCCTGGGGTTCCACTCCGAACTTATGAATATGGCTCCTTTCCAATAATTTGTTTTCCACGGTATTGT TAATTTTCCTGCCCCCATTAAATTTTACCTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 672230: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722301537177AA051970SWMFCA465SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:17:35 on Thu 23 Nov 117.