EST 672235 is a singleton


Sequence

>672235 (1 EST) Length=436 GCTGTAGAGACCTGACGAAGCGTCTGTGATGAATCATNGTATTGGTCGTGATAAATTTGGTGGTGGTGGTAGTCAAAGCT TTGGTAGCCGAGGTGCTGGAAGCAATAGCAACCGANGAGGAATGGGCAATCGAGGTGGTCCACGTATCTTTACTGGTCGT GGTGGTGGGCTAAGTNGTGGTGGCCGTTCCGGTGGTNACTTCNGCGATATAAAATATGATTTCGGAAGTCGNAACGCTTC TGGTGGTATCCACCTTCGCCCAATCGATTGGATTCATAAAAATCTACGACCGTNCCAAAAAAACTTGTACCNTGAACATT CTGCCGTCNTGCGTTACGGAACAGGTTGAAATATACAGATGGTTTACGGGATAATCGTGTTCCTGTTTGAAGGAAACTAA CTTCCTCCTCCAATTTTTGATTTCCAGGAAACTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 672235: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722351537182AA051975SWMFCA528SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 5:15:46 on Sat 18 Nov 117.