EST 672236 is a singleton


Sequence

>672236 (1 EST) Length=429 CCTTCCTGTGTCCAGGCTCNTCCCATGGNCTCAAGGAAACTGTGCCCCCTGTGTGGGACACGGACCGCTTNCAGNCTNTC AAACGGTGCTTTGTAACACGACGGGACCACTTGTGTACNANGGACCAAAAGCTGTAACTGNTGTCTCATAGGGCCCCNGT TCCAATCNTGGNCATNGTGTGTGCTAGNTCCCNGANTACAAATAAATCTGTCCGGTNCGCTNCGTGCCATAGCCCACATG TCTGCCTCTATACGTGTCTGGGCAACCTGTTTGTTTCAAAATGCCTGACCTTGTGTCCCCTCATAATGGNTTTCCCGAAG GACAACATGGGGATTAACAGCCACTTATCCCCTCAGTACCTACACATCATGCGTGTGATTGTCTGAATGCCCAGGGACCT TACCAAGGATCACATACATTCTATCCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 672236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722361537183AA051976SWMFCA534SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:3:8 on Wed 22 Nov 117.