EST 672240 is a singleton


Sequence

>672240 (1 EST) Length=508 AAAAGAATGAGGTCACAGGCGAAGAAAATGACACAGATGTTACTTGTAACAGTGGTTTACTGAGTCCGCAGTATGTAAAT GTTGAGAGTGCACAGCCAGCTTCTGTTGAAAGGGGTAAATTACAAGGCACGAAATTTCCTTTTCCACCACTAAGGCATAC TCGTTTTTCCGATTCAACGGCTTATGAAACCAATCCAGTTCATATGGACAATTTGAGAAAGCCAGCATTTGAAGGATCCC TATCAGCGTTCACTGTTAATCAAGCAAATATTTTACTAACAGAGGTGAGTAAGGAAAACCCGACTGAATCCTCAATATCG AAGTCAAACAACAATAACCAGCAGCGAAGATTTTCCGATCCGAATCAAGTTCAAGTGGGCGAAGTGGTTCCCCCAGGGAT GTTCTAACCGCCAAAAGTCTGGGGTGGTGTTTGCCCGAATTCCTGTCCAATTGAATGCAGTGGAGAAAAGCAAACTTATG AATTGTATCGCAGCACACACCAGAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 672240: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722401537187AA052009SWMFCA713SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:47:14 on Thu 23 Nov 117.