EST 672245 is a singleton


Sequence

>672245 (1 EST) Length=313 GATAAATCCTGATGCAATTCCAACAACTCTAATACCATTTGTAAAAGCAGCCCANAATAGTACGATGTTGTCAGTTACAG TTGCTGTTGGTTGTGGCTTATTATTCCTTAATATATGTATTGGCCTTGGTCTTTACAGGCAGGTATGTTTCTTTCTTTCT TTCCTCTTTCAAATCTATTAATCTATCATTTTTAATAATTTAAAGTTTTTAATTTATGATATAATTATTTAGCTTTTATA TATCCTTTTTCATTACTTTCTCCTTTATTTTTTTAGAAATAATAAAAACAATTTGGAATTGATAAAAACAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 672245: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722451537192AA052014SWMFCA718SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 5:48:17 on Sun 19 Nov 117.