EST 672261 is a singleton


Sequence

>672261 (1 EST) Length=365 AAACAACTTTTTATCTCTAAACACCTTTCATCATTTTAAAATTTACTTTAATTTTGAAAAATTAAAATACAATTATATCA TGTCTTCTTTCACTCTCCTCCCTCTAACTCTTCCCATGTCCCCCACCCTCAAATTCATGGCATCTTGTTTTTGAGACAGG GTTTCTCTGTGTAGACCTGGCTGTTTTGAAACTCTTTGTGTAGACCAGGCTGTCCTTGAACTCAGAGATACACCTGCTTC TGCTTCCCAAGGGCTGAGATTAAAGGTGTGCACTATCACTGCCTGGCCAGAGCCTTTCTGTTTTTGTTATAATTACATTT TCCTATATTCCAGGCTTGTTCTAATAATGGGTTTAGACTAGTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 672261: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722611537208AA052030SWMFCA749SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:14:32 on Tue 21 Nov 117.