EST 672273 is a singleton


Sequence

>672273 (1 EST) Length=361 TTTGAGATGTATATTTTTGGTGATGAGTCGGATTTCACGAATCAAATTATCAAATTAATTACTAATGCACCAATCGATGC CGAGCAACACATCATCGGTAATGTAAATGAAATAATATCGAGAGAGCCGATTATTTTTCTTTGCGAAACAGCTGACTGTG AAGCTATAAAGTGTGCGATACCTTATCTAAATGAAAAATTGCCGATTATTTTTATTAAGCAGCAATGGAGCAATGAAGAA CTGAAACTTGTAGAAATAACCATCCAAGAATCATTATCTATGAGAAAACAGCTATGGCACGATGAAATTAAAAAACTAAG GTTTCAGGATCGATGCATGAAAAAATTTGGATAATATTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 672273: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722731537220AA052042SWMFCA764SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 3:54:17 on Sun 19 Nov 117.