EST 672281 is a singleton


Sequence

>672281 (1 EST) Length=520 TACACTATGGCACCATGTTGGCAGTGCAATGCGTCTGCTTCGGTGAAGAGGTCAAAGGATGGTAAATATGCCTGTGTCGT TTGCTTCACTGATGCCTTCGAAGCGGAAGTGCATAACGTGATTAAAAGTTACGGTTTATTCGGCAAGGGTAAAAAAATTG CTATTGGAGCGTCAGGTGGTAAAGACTCGACAGTACTAATTCATGTATTAAATAAACTAAATCAAAAACATGATTATGGA TTGGACATCATTCTGCTTTCAGTCGATGAAGGAATCGCGGGTTACCGTGGTGATTCCGCTAAAAGCCGTTGAAAGAAACA GAAATGATTATGGATTACCGTTGGTTGTAATGTTCTTATAAACAACTGTATGGTTGGACGAATGGATGAAATAGTGTTCC GCTGTTGGTGCTAAAAAATAACTGCACTTTTTGTGGTGTTTTTCCGGAAACTTGCCCCTAAACAGGGGGCGCAATTGAAT TGTTGGAGCCACATATTATTGCAACAGGGCATAATGCCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 672281: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722811537228AA052050SWMFCA774SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:8:18 on Wed 22 Nov 117.