EST 672282 is a singleton


Sequence

>672282 (1 EST) Length=353 AAAACATTTCACTTGTTGCGAATAAAGAAATTTTTTGGCATTATTCCTAATTTTCGTTAGCTTTTTCAAAACTTTCTTTT TATTTTCTCCACTTCTCAGGCAGCAGTATTTACATATGACTTTTTTTTTCCAACCTTATAACCTTATACCTTGAATTCTT AATTAGTGTAAGTCTCATTATCATCATGAAAATGTATTTATCTCTCCCTTTTATAAGTATCTTCCTATCAGTTTGGCATT AATAATCAATATTTTGTTTGAAAAGATTTGAAAGTATTAAAATCTTTCAACAAATATTGATATTAAGGCAAAATACTGGA TAGGAAGATACTTATAAAAGGGAGAGATAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 672282: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722821537229AA052051SWMFCA775SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:48:55 on Sat 25 Nov 117.