EST 678682 is a singleton


Sequence

>678682 (1 EST) Length=553 CTTTGGGAGCCCACGCTTTTCCCGGCGTTGGGTTTGTTGTTGTACTCGTTTCACTTGGAGTTGCGTCGGTAATTTGGGCG TCTGGCTCTTGTAACGTTCGGGTGCATTTTTATCGTGTGACCCTGCGGAGGGAGCGATGCGACGTTCACTGCGGATTCTG GCACTTGATCCATTTGCGGTGCTGGGGCTTAGTCGTAGTTCCACAAAAGCCGAGATCAAGACGCGCTTTCGTGAGCTCGC ACGTTTACATCACCCGGATGCTCCCGCGGGTAACAGCGAGAAGATGGAGCAGGTGAACAAGGCGTATAACATGTTGATTA AGGAGGGTGCGTATGAACGGATGCGCATGAAGTCGCCTGGGGTAAAGGCACGTGGCCGACGTGCGTTCGTCCAAGACCCT TTTTCCCAGGAGTCTGAGCGGCAGCCGCAACAGCGAGAAGAAAAGGAAACCCCGTATGAGGGCACTTTCAGAGGAAGAAG TTGCCCAAGTTGGAGTGCGCTAGATCCGACCACCAGAAAAGGGTTTACACCGACTGGAACTTACATGTATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 678682: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786821542816D87300D87300Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 4:13:32 on Fri 24 Nov 117.