EST 678686 is a singleton


Sequence

>678686 (1 EST) Length=274 CATTGCGCTCCTGATGAACAATCAGGCCAACCGGTACGGCGCGCTTTGTGAGGTGGTCTGATGGCATGAACGGCGTGCCG TTGCTTGGCGCAGAGAAATGATGTGGCACCTACCATTTCACTTGTGGGTTGGCGTGTGTCTATGCCGCCGCCCCCTGTCG TGGTCATTGCTTCACGCAGTTAAATACATCTGAATTTTGGAAGAGGAGTTAAGGATTTTGTTAAAGGGGAGATAGGAAGA GTTTGTTTAAGAGGTGTCTGTTCAGATTTCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 678686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786861542826D87307D87307Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 4:38:17 on Sat 25 Nov 117.