EST 678687 is a singleton


Sequence

>678687 (1 EST) Length=357 AAAAGAGGATACAACCGTTGGAAGGGGTGAGGAAGGAACCCTGCAAAGAAATCTTCTCCCTTTTCTTTTTTTACTTTTTT GCTTTTTTCTTTTTTTGTCTGTTATATTTCTTTTGAACGGCCTTCTTCTTTCTTTTTGACGCTCGTGTTGCTTCGCTGTT GAATCCTCCATAAATTGGACCTCCTTCCCCCAAGGCTTTGGACGCAACCGGAAAAACCTCTTTTGCCTCCTCGCTGCGCC TCTCCCTATCCATGTTTGCGTGCATTTACACTTGTACATGAATATATCCGTCTGTTTCAACTTTCTTATATTATAATCAT GTATCCGGGTGTGTTTTTTTGTTTTTTTTCTTCTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 678687: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786871542827D87308D87308Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 18:47:32 on Sat 18 Nov 117.