EST 678699 is a singleton


Sequence

>678699 (1 EST) Length=564 GTTTCTGTACTATATTGTTTGAAAGGCAAAACAGGAGCAAAAAAAAAAAAAAAAAGAGGCCCAAGGGAGGCCTCATATTT ATTATTGGAAATAGAATGAATGAGGTTGATGAGCAATTAGATGAGCTAAGGCTTGTAGCTGTTATTCTTGATACACTTTC AAATACGGAACAAGGGCTGCGTCCTGATCAAGTAGTGCCTTTGAATGCTCGAATACGCCAGGCGGTGGAAATCATAGAGA CTGCATGTGCTGGGAGGAAACCGAACTTAAGCAAAAATTCTGGTGAAAAGGACCGTTTTAAGCGGGCCGATGGTTTACCT GAATTAACTCCCCAAGTGAGAAAATCATTGGATATCCCGTTCTTTGAACCTTGCCACAAAAACCAACAGTTACTTAAGCC CCCCAGTATCAGGGATTTCCAGTTCCCAGGGAAAAAACCCCCCCGGGGACAGTTTAACCGGCTCAAAAAAGGGCCCCCGT TGTTTGGGGGGCCCAATGTGTAAAATTTTGGGAGGGTCAACGGGGATTTTTTAAGGGCCAATTTCCGCCCAAATTTTTGT TCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 678699: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786991542839D87320D87320Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 9:49:10 on Wed 17 Jan 118.