EST 680672 is a singleton


Sequence

>680672 (1 EST) Length=532 CTCGTGCCGGCACGAGGCGGCTTGAAGCAGTCAGTGAGTGGGACATTTTCCGAACTATGTATTCACAAGAATGCTACCGC TGATGACGATTGCGTGCATTCTTCCAACAATTCCTATCTTCATTTTCTCATTCCTTATTATCGGTTGTTCTTCCAAAAAA GCAGAACCTGAAGTAGGCGGAGAAAGAGGAGGGAAAAGGACTACGTCAGCAGGTCAAGGGCAACCAGTAACAACGCCAAG GTCAACAACACCCGCAACAGTACCTCCTCCTGTTGTGCCCGCAGAAAAGAATGCACCGAAGAAAGAGACTAATACCGCTG GTGCTATGGTTGGAGGTGGTGAAGAGGAAGATGGGGGATACGAATCATGTCCTGATATGACACCTGAACAACTTGCTAAA ATTGCAAACGAGTCTCCAGCAAAATAAGTCAGTAAATAACGCAAATAAAATAATGTATATGAAGCCGATTTTGAAGCTTT ACTTAAACTGTAAAGGGAATTAGTGAAATCCTAGCATAGCATAAATCTATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 680672: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6806721547235AA054901SWAMCA1488SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 13:17:56 on Thu 23 Nov 117.