EST 680675 is a singleton


Sequence

>680675 (1 EST) Length=525 TCTTGAGTCATCTCATAAGAATTTTATTATATATTATCAATGGATCGCTTTTATTTTCCTTTTATAAAGATGGAAGTGGA TGAATGAATATTTGCATGATGAGTGAGAATACAAATGGTCAATGCGCACAGATATGCCTACTTTTCTATACCGTTTTTTT TTGGCTTACTGGATTGGCACTGATATTTTTGTCGCTGTGGACATTGCTTGATCCACGTCGTAATTATCTCCTTGACTTGG TCGATTTCTCGGAGGATGATCCATTACTTCGTGGAGCCTGTCATCTGGCTCTTATTACTGGTTCTGTTGTAATGATAGTT GGCTTTATTGGTTGCTGTGGTACNATAAAAAAATCGTTGTGTTTGCTCATTACCTTCGTGATTTGTTTATTGATCTTATT TTTTGCTGATATAACAATCGCTTGCCTGGCACTGTTCTACCGCAACAAGTTTGTTGGCAATAGACTTAGTGTGTATTTAA CAAATTTAACACACGATCGGTATTATCGTCTTTATTGGGTCACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 680675: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6806751547238AA054904SWAMCA1492SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:30:25 on Fri 24 Nov 117.