EST 680694 is a singleton


Sequence

>680694 (1 EST) Length=535 ACAGAGCAATTTGATTGCTAAATTTATGATTTAAAACAAACGAAATGGGGGAGAGAGTGAAAATCTAAATAAAATTTTGG TTTGAATAATCAATTTATTTTTATTTTTTGGTTTAAATTGAAATAAATTTTACCAAACTGCAAATTTCTGAAATTCACTT TTTTTTATTGCAATGGAACAGTTAATTTTTATTTCGAATTCAAATTTCAGCTTATCTATCAAGACNAGGCATTGATCCGG CAAAATATCGGCCGAAAATTCGATTTAGTCCCGATCAAATTTTATTAACACCCAAAAATCCTACCATACCAGGATGCATC AAAATTAAAGCACTTGGTGTTGAAGTTATACGACCAGTAAGAAATCTAGTCCGCTGAAATTGAAATGCGAATCGGTGGTA TACCGGATCCAACTTATCCGACATTACCATGTTTCGGAAAAAGTTTAACAGCAAAATTAATCAATGTCCCCTGTGGAAAA TTGGGAAATACTGGTGTTTTTTGCAATTCCTGTTAACAAATGCGGAATCAACCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 680694: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6806941547257AA054923SWMFCA796SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:10:48 on Thu 23 Nov 117.