EST 680695 is a singleton


Sequence

>680695 (1 EST) Length=538 ACACTTATACCTATNCATCTGTGCGGACNNANGANNTCATAATCGANATAATCTCTTGTATTTACGACATTTGCCAATTT TTCCGCATAGTTATGAAAAGTACAGGTTCANTATTGACAAGTAGTATCAGTGTGCTAATTGTTTTACGGGATTATCATAA TGATTCANCGTACGGTGATAATGTCGATGAGTCATTAACAGGTNTTGTTCATTGCATCAGTCGTCGTCGTCGNNATTGAT GACATATGTATCGTGTNTCTTTTCCGGATGGTTACTGGAACTGATATTCACTGGGGGCATATTTCTTTTCTTTCCTCTTT CTTCTCTTCCCTNNNCCTCCATTCTCTGTCCTAACATTTCTTAACGTCGTGACGCTGTCCTTCTTGGGTACCATTGGTGT GACTACTAGTACCGCACGTTACCACACCTATCGTAGGTACCACAACATTATTGCTATGGTTTGTTTAAATCCGTAGCTAT CATAACATTATCACTATATTCCGTCGGTGGCATTACTACCTATAATTATATGAATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 680695: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6806951547258AA054924SWMFCA797SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:15:21 on Sun 19 Nov 117.