EST 680696 is a singleton


Sequence

>680696 (1 EST) Length=530 TNAATTTGTATCNGCCAACNACTGTGGGGGGATCTGTCCCACTTCTGCNTTGATTCNATTCCCATCATTATTTCTGAGCT CGAAAGAACAATCAGTATTATTGAGTAAAAAAATGTTTCGAATTTTTAACGGTTCTCATTTGCATACAGCAAAAGATGGC GGAAAAATTCTTACGAAACCTTTAATGATTTTGGTATTTACTGGTGACAATGATGATTTGTTTAATCGTATCTTAGAGAC TCTGAATACGATGATACCATCTGATACTCATACTGTTTATCATTTATCATATGAAGCATTCTGTAAACATCCATGGATTG GACAAAATATTGCATGCTTGATTGTAGCTGATACATCACATTTGGATGATAAATGTTGGATTCGACTTCAGCAATATTTT AGTTGTTCAGGCAAAATTCTCTTCCTATGTCAAAATAAGCTTTTGGCAAGTTTATCGGCTTGTTGACAATTCCAAAAAGA ATACTAAATTGCTGAAGATGGCATTTGGTGAACGACAGTCCAAGAAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 680696: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6806961547259AA054925SWMFCA798SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:47:32 on Fri 24 Nov 117.