EST 680702 is a singleton


Sequence

>680702 (1 EST) Length=481 GCTGCAGCAAAGCACACCTTGGAAATCATGATTAAGAGGTCCAACTCTACCCCAGCTACCAACGAGGTTCCTGAGGTGAC CGTGCTTCCCAAGTCCCCCGTGCTCCTGGGTCAGCCCAACATCCTCCTCTGTCTGGTGGACAACATCTTCCCCCCTGTGG TCAACATCACGTGGTTGAGAAACAGCAAGTCAGTCACAGACGGCGTTTATGAGACCAGCTTCCTCTCCAACGATGACCAT TCCTTCCAAAAGATGTCTTACCTCACCTTCATCCCTTCCGATGATGACGTTTACGACTGCAAGGTGGAGCACTGGGGCCT GGACGAACCGGTTCTGAAACACTGGGAACCTGAGATTCCGGCCCCCATGTCAGAACTGACAGAAACCGTGGTCTGTGCCC TGGGGGTTGTTCTGTGGGCCTCCGTGGGCATCCTGGTTGGGCACCATCTTCATCTTCCAAAGGCCTGCGGTCAGGTTGGC C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 680702: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807021547265AA054931SWMFCA807SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:48:35 on Sat 18 Nov 117.