EST 680718 is a singleton


Sequence

>680718 (1 EST) Length=331 GATACACTCTGTGTAGTTTTGAAGAGAAACACTTTGCGAGTTCGTGAAGCGACGTTGTTCCTCGCAGTACTTCGATGGAC TGTGGAAGAGTGTCGCCGTCGGACCTTGACCATCAACGCAGAGAATCAACGAACAGTACTTGGCAGAGCTTTACATATGA TACGTTTTCCGCTGATGACAATTGACGAGTTTGCACAGCATGCTGGTAAATATATTCATTTTGAAACTTTGATTTGGCGT TAAGAGCTTTTCTGCCTAAAGTTTAAGAAAATTTTCGACGTCAAACAGGTATACTAACTGATCGTGAATTGGTCAGCCTT TTTCTGTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 680718: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807181547281AA054874RRAMCA231SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:52:6 on Sat 18 Nov 117.