EST 680741 is a singleton


Sequence

>680741 (1 EST) Length=269 CCGGGTGCTTATCAGACTTTTGTACATCTTTTTTACGGAATTTTTTTTTTTTTTTCCTGAACAAAATGTTTTCCGGAACT CCGCTTGAGACTATCCGTGTACTGAAAGGTAAAACAGCTAGTCGTCCGTCATTTCAACGTTCCGCCAAAGGAAATGTTTC TATCCGGGTTGCTGCATCAGATGGAAAATATGTTTTATTGGAGAATACACATCGTTCAAAGGAGGAAGCAATTGGTAAAT GGAGATTGAAACCAAAAATTGATGGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 680741: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807411547304AA054897RRAMCA291SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:20:2 on Sun 19 Nov 117.