EST 682585 is a singleton


Sequence

>682585 (1 EST) Length=536 CAATTTGAGTTTGAGTATATTGTATATTGGATAGTGGAAATTTTGGTTTATTTTTATAACAGTTATGGTTGTTCATCACT GTAATTCGGATGCAGGATTTCATGAATTTTTGGCAAATGCTGGCGCAAAACCTGTTATTGTTGATTTTTATGCAATCTGG TGTGGACCATGTCGACNAATAGCACCAATATTTGAGCAACTTTCCAATCAATATTTAAATGTTGCATTTCTTAAAGTTGA CGTTGATAAGGCAAAAGATCTATCGACACTTCAGGGAGTTACTGCAATGCCTACATTCATTGTATACATGAATAGGGTGA AAGTTGATCTTTTGCGCGGTGGTGATCCAAATGCATTAGAAGCATTGGTAAAAAAATGGTCCGATAATGCACCAAAAGAG GATAGTTTGGTCGTGGGACAAACTGATCTCATAACATTTGTTGATAAAACACAAGTGGAATGCTTAAATGAAGATGATAA TGCAACATTAAGGAGTCTACTTAATGGTAAAGGTGTGCTTACATCTGATTGCGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 682585: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6825851549413AA056783SWAMCA1515SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:46:25 on Sat 25 Nov 117.