EST 682588 is a singleton


Sequence

>682588 (1 EST) Length=500 CGGGCACGAGGTTTATGATAAGCTCAACATTTTTACTGATTAGTAAAAATGTAAATAATAAACATTTTACAAAGCTAAAA TTTCCTTTGTGGTTTGTCTGACTTAAATTATCAATCTTCGACCGATAAAGCTAAGCTAAGCTTTAACTCTCGAAACTTTT TGTCGGCACAATTAAGAGCTGTCACTTTTTTTTNCTTCTCTTTCATTTTTCATAAAACATATGCCTGTCCTGTCCTGTCC TGTCCTATCCTGTCCTGTCCTGTCCTGTCCTATCCTTTCGTTCTTTCCTTTGAANATGAAATTGCTGACCGAAGAAGAGG AAAAAGATTTATTGTCNTCGCTGTGGCGGATGCATTGTTACTTATCGTAGTGGTAATTCTTTCTGTCTGTGGCCTTCCCG TCTCCTACCCTGTCCCCTTCCCGTCCTCTTCCCATCCCCTTCCCGGTCCCTTTCTCGACCCTTCCATTCAATTCCATTTT TGCAGTCTATCCTTTTTCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 682588: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6825881549416AA056786SWAMCA1519SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:33:47 on Wed 22 Nov 117.