EST 682602 is a singleton


Sequence

>682602 (1 EST) Length=217 GCTTTTCTAGCCAAAGCGCGGACTTATTTCCCATTTGGCGACAAATGGAATATTTGTAAAATTACTTGTAATCTTCAGAT TTTCAAAATATGCCAGAATGTTTCTAAATTATTTTTAAGAAAAATCTATCTTTTTTAAATCATTGATTTCTGTAGTTGTT TAGTATGAACAGTTCTTCCTCTGGAGAAGTAGTGGTAAAAATTGATTCAGTTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 682602: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826021549430AA056770SWAMCA1537SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:54:27 on Mon 20 Nov 117.