EST 682603 is a singleton


Sequence

>682603 (1 EST) Length=552 GATTTGTGCGATGGCCCAAATATATTCGTTTACAACGTCAGAAAGCTGTTTTGATGAAACGCTTAAAAATTCCACCACCA ATTAATCAGTTCCGTACAACACTTGATAAACAGACAGCTACGCAGTTGTTCCGTTTGGTAGATAAATATCGTCCAGAAAT GAAGCACCAGAAGACGGAGCGATTAAGGGCGCGAGCGGAAGCTCGGACTGCAGACAAAAGTGAAATTTCTCTTGCATACT GGACAACTATACGGCTTTTCACCGGTATGAGTCATCACATGTTTTTTCATATGTGTTATTTCCTTTTGACATATATCACA ACGCCGTTTCTTTCCTGTGCTTTCTTTTTCTGGTTCAATTACTTCCGTCAGTGTTTCGATTGGAACAAGTCGTCGCGGTT TAATTCGTTCATCACTCACTCTTTTCACTGATAAGCCTTGCGATTTATTTCCTTCCTCTTTCACTTTTGATATTGATAAA TCCAACGGTTCTGTTTGTTCCGTTTGCGCTACCTTAAATGATATGAAATTATCAATGAAAAATCACTGTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 682603: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826031549431AA056771SWAMCA1538SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:35:10 on Fri 24 Nov 117.