EST 682610 is a singleton


Sequence

>682610 (1 EST) Length=573 ACGAATCTTTGGTACATCGGAAAAAAAGGAGCCACAAACAACGCTAACCGATGCAATAGCAAACGTTGACTCACGTACCG AGAGCATTGAGAAAAAGATAGCTCGTTTGGATGGTGAACTTGTGAAATACAAGGATCAGATGAAGAAAATGCGGGAAGGA CCGGCCAAAAATCAACTGAAACAGAAAGCTCTACGTATACTGAAACAAAAACGTATGTACGAGAACCAGAGGGACCAACT AAGTCAACAGTCTTTCAATATGGAACAGAGCAACTTCGCTATTCAGGGAATGAAAGATACCCAGACTACTGTGTTGGCCA TGAAACAAGGCTTGAAAACTATGCAGAAGGAATACAAAAAGTTGGATATTGGCAAAATCGATAAACTTCAGGATGAAATG GAGGAAATGCTTGATATGAATAATGAAATTCCAGGAAGCTATGTTCGCGACAATATGAGACGCCCAGATATTGATGAAGC TGATTTGGAAGCTGAACTTGACGCTTTGGGGGATGAATTTGAACCAGACATAGATACTTCCTTATTTAGATGAAGCTTTG AATGCCCCAGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 682610: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826101549438AA056798SWMFCA1000SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:42:37 on Thu 23 Nov 117.