EST 682619 is a singleton


Sequence

>682619 (1 EST) Length=551 GTGAAATGACGGGGATGTCACGGACGGGATGGCCTGTTGCTACTCGACCACAGAAAGTTGTTACCACTCCAGTTACATTG AAAAAACCAAATGATACTCGTAATAGCATTGATCGAGCTATCAATTTGTAACATTTTCCGTTTATGTTAAAAATACATTT CTTTCTCTTGCTAGCAACAATCAAGTTGCGAAAAGGGATTTAGTTTTTGTAATTTGAGTCTTTGAAACACAAAAATTGCT TAAAAAAAAAGACNGGGTTGGAGAAGACAAGAAGATGAAAGAAAGGATGATGCGGATAGGAGCGTTGATAAACCAAACGA AATAAATTGATAATTTCATCTGCGAAGATTTGTAATTGTTAATTACGATTATGAAAATGTGGTTTTAATGAAGTTATTCC GATTATGATTTCTGGGAATTTTAACAATTACTTTGTCAATTTCATGTTATATAAAATCCGTTAAAATAAGTATTTGAGAT ATCCACTGACGAATTACCCTTTGGGACGAAAGATCCACAAGCTGAACGGGACCATTCAGTTGCAGGCCCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 682619: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826191549447AA056820SWMFCA1017SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:40:13 on Sat 25 Nov 117.