EST 682622 is a singleton


Sequence

>682622 (1 EST) Length=547 TTTAGCTGTGAGCGATTTTAGATCTCCCAATTGGATTTAATCTCTCAAGTTTTTAGTAAATCATCTAAAGATCATCTCAT GTACTAATGCAGGTAATACTACCTATTTTGGTCACTAATGAAAATTCCAAAAAGTTTTGAAGTGAAGGGTGACTGATAAA TAATAAATCAGTAGAAATAGCTAAATGTTTGTTTACTTTAGCCATCGAATTTGGAACGAAATTTACACTTTTCGAAAACA AAAGATTGATTGGAAAAAAGACAAACCTTTGTAGAAGCATGGAAATTTCCAGCGAAACTTTCTCAATAATATTTCTAGCC TCCTGAAGTGACATTCCTTTCGTGGTTCGACCGGAAAATTCAGTGATCGTATCACCTATTTGTAATCCAGCTTTATCTGC TAGGCTTTCTTTTTGTACCTGAAGCATATTTATGGGGAGTGATAACTCAGGAAAAATCAAGAAAGAAACTCCTATAATTG ACAATATTTGTTAATTGTTTAACAAAAGAATCCATCCTCTTCCTCTCGTTTTTTTCCCTTTTTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 682622: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826221549450AA056823SWMFCA1022SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:24:12 on Fri 24 Nov 117.