EST 682641 is a singleton


Sequence

>682641 (1 EST) Length=409 GAAAAGAGCCTCGCTCAATCATGTTGTCCTTACATTTGATTTCCTAGCGATGTCGTTCGGTGTGGATACGGTTTGCGAAG TTGGTTTGAAGTGTCTCCCAGTTGCGTTTGGAACTTTCTCTTTATTTATTAAGGGNTGTAATCACTGAATACTTAGTGGT AAATTGGGTGGAGAATTTCATCAAACGTATTACTGGATAGCATTATAGTATTATCAAGTGGAACCTTTCGTTCCTTTGCA ACACTCTTTTCTATTCAATTTGAAATCAAGCTTGGGTTGTAATGTTGAATCAGTCGTCGTCTTCTTCCACTAAAAATTAT ATTGAAGTTTGTGGCGAAAATTAACGAAATGTTATACTACGGGCAGCTTCCCCAACAACGTTCTCCCTAACGGGTGGGTA CTGGGTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 682641: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826411549469AA056842SWMFCA616SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:53:47 on Sun 19 Nov 117.