EST 682642 is a singleton


Sequence

>682642 (1 EST) Length=540 CAAGAACGTGCTTTTTGGGATGTTCATAGGCCTGTCCCGGGTTGTGTAAACACAACAGAAGTTGATTTCCGGAAATTATC AAGATCAGGTATGATGATGATGGATGCATATTCTTTGCTCAATTATTACAGTGAGAATAAGTGGGCATATTGAACATGAG AAGAATTTTTCTATCATTTTATCACTATGCAAATAATTCTATATAGTCATACAAAATGGAAGAATTAATTCAGTTATTGA TTAGCAAATCCTTTATTAGTTTTTGCTATAATTAAAAGTAACTTTTAAATGTTAATAAATGTTACGTTGAATAATTAATT ATAGGGCGACCGAAGTTACAGTTCATCTACTCCATGCTGCTGTTGCATCCATGTTTCGAAATATCACTTTACCATATTCG ACTTCTGCTGCAGCTGCACATGCAGCTGCACAAACGCCTCCTTGCTCCAGTTTCCCATTTTAAATGGTGCCAGCTAATAA TGCATCCTCCCCCCCTGGGAACAAGTTCAACAAACATCCCCCTTATGTTTTCCACCCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 682642: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826421549470AA056843SWMFCA617SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:12:31 on Fri 24 Nov 117.