EST 682645 is a singleton


Sequence

>682645 (1 EST) Length=109 AATACATTGAATTACGCAAGCAAAAAATGGCATTGAAACGAGCTACTGGTAACGTGAAAACTTCCTCACCAAAAAAGCCA CGAGCACGTAAAAGCGCTCCAAGTGGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 682645: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826451549473AA056847SWMFCA623SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:31:30 on Sun 19 Nov 117.