EST 682664 is a singleton


Sequence

>682664 (1 EST) Length=163 AATTTGGTCGTAGCTCTCAATTTACATCATTTGATTATGAAATAGATGAATAATATGATAAATCTCTTCTATGAAATCGC TATTGATTTATTCTTTATTTCCAACATTTAATATTTTATTAGAGAAAGAATAAATAAGAATAGAGAACTTGATTCATAAG TTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 682664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826641549492AA056813SWMFCA766SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:15:44 on Sun 19 Nov 117.